Biologics Tutorial: Add Sequences to the Registry

Documentation
This tutorial provides step-by-step instructions for adding an antibody, Aducanumab, to the Biologics registry.

Along the way it illustrates:

  • Adding nucleotide sequences to the registry
  • Options for translating protein sequences from the above
  • Entity relationships
  • The protein classification system which detects and annotates protein formats and components
  • Calculated values for new sequences
This topic describes the manual process for adding a single entry to the registry. There are other options for adding entities, including bulk import options, importing GenBank files, and API-based insert methods.

Note that when you create your own entities, the registry names are auto-generated, and therefore may differ from the names shown in these tutorials.

Set Up Trial Server

  • This tutorial assumes that you have registered and created a Biologics Trial instance of the server.
  • If you have already created a biologics trial server, select it, and login: Your Sites

Register a Nucleotide Sequence

We register a sequence composed of a leader sequence + the light chain for Aducanumab.

  • On the Biologics home page, click the Registry button.
  • On the Registry page, click Nucleotide Sequence button.
  • On the Nucleotide Sequences page, click Create and select Nucleotide Sequence.
  • On the page Register a New Nucleotide Sequence, fill out the form as follows:
  • Description:
Signal Peptide 4 + Aducanumab Light Chain. The Light chain sequence of a IgG1 monoclonal antibody, which targets aggregated forms of β-amyloid (Aβ) in the hopes of reducing its buildup. Leader sequence HV103_HUMAN has been added.
  • Alias: Add the two values below. Hit the Tab key to confirm each entry:
Aducanumab Light Chain

HV103_HUMAN
  • Nucleotide Sequence Parents: Leave Blank
  • Sequence: Copy and paste this sequence:
ATGGACTGGACCTGGAGGATCCTCTTCTTGGTGGCAGCAGCAACAGGTGC
CCACTCGGATATTCAGATGACCCAGAGCCCGAGCAGCCTGAGCGCGAGCG
TGGGCGATCGCGTGACCATTACCTGCCGCGCGAGCCAGAGCATTAGCAGC
TATCTGAACTGGTATCAGCAGAAACCGGGCAAAGCGCCGAAACTGCTGAT
TTATGCGGCGAGCAGCCTGCAGAGCGGCGTGCCGAGCCGCTTTAGCGGCA
GCGGCAGCGGCACCGATTTTACCCTGACCATTAGCAGCCTGCAGCCGGAA
GATTTTGCGACCTATTATTGCCAGCAGAGCTATAGCACCCCGCTGACCTT
TGGCGGCGGCACCAAAGTGGAAATTAAACGCACCGTGGCGGCGCCGAGCG
TGTTTATTTTTCCGCCGAGCGATGAACAGCTGAAAAGCGGCACCGCGAGC
GTGGTGTGCCTGCTGAACAACTTTTATCCGCGCGAAGCGAAAGTGCAGTG
GAAAGTGGATAACGCGCTGCAGAGCGGCAACAGCCAGGAAAGCGTGACCG
AACAGGATAGCAAAGATAGCACCTATAGCCTGAGCAGCACCCTGACCCTG
AGCAAAGCGGATTATGAAAAACATAAAGTGTATGCGTGCGAAGTGACCCA
TCAGGGCCTGAGCAGCCCGGTGACCAAAAGCTTTAACCGCGGCGAATGC
  • Annotations: Leave Blank
  • On the bottom right of the page, click Next.
  • On the Confirm tab, review your entries and click Finish.
  • The registry nucleotide sequence will be added to the registry. The name of the sequence (in this case "NS-224") may be different in your registry, as the name is generated automatically. Once a new sequence is added, the registry enforces its uniqueness: if you attempt to register the same sequence twice, you will receive an error message.

Translate and Register a Protein Sequence

To translate a protein sequence based on this nucleotide sequence, follow the instructions below.

  • On the Nucleotide Sequences page, click NS-224, or whatever the system has named your new nucleotide sequence.
  • On the nucleotide sequence details page, select Create > Protein Sequences. (Note there are similar workflows available for Constructs and Vectors.)
  • On the page Register a New Protein Sequence, enter the following information in the form:
  • Description: Leave the automatically entered text unchanged.
  • Alias:
Aducanumab Light Chain
  • Organisms:
Human
  • Protein Sequence Parents: Leave blank. (Use this when parent protein sequences are already in the registry.)
  • Seq Part: Leave blank. (Use this when you know the sequence type, like "Leader" or "Linker".)
  • Click Next.
  • On the Sequence tab, click the dropdown Translation Frame and select "1". (Note that selecting "2" or "3" will re-render the sequence preview panes, as will manually refining the Protein Start and End points.)
  • Click Next.
  • The system searches the protein classification library and generates annotations for the sequence parts.
  • Click Next on all remaining screens of the wizard. The wizard shows you calcluated information on the following tabs:
  • On the Annotations tab, review the information, and click Next.
  • On the Properties tab, the system calculates a number of physical properties of the protein sequence. Review the information, and click Next.
  • On the Confirm tab, click Finish.
  • The new protein will be added to the registry. The auto-generated name of the new protein (in this case PS-221) may be different in your registry.
  • Click the name of the new protein to see the details page. Under Related Entities, notice the link to the originating nucleotide sequence (NS-224).

Optional Steps

Register the Heavy Chain Sequence (Optional Step)

  • Repeat the tutorial steps, using the heavy chain sequence and leader sequence below.
  • Enter this Description for the sequence:
Signal Peptide 6 + Aducanumab Heavy Chain. The Heavy chain sequence of a IgG1 monoclonal antibody, which targets aggregated forms of β-amyloid (Aβ) in the hopes of reducing its buildup Leader sequence HV303_HUMAN has been added.
  • Enter these two Alias values:
Aducanumab Heavy Chain

HV303_HUMAN

Aducanumab Heavy Chain Sequence + Leader HV303_HUMAN

ATGGAGTTTGGGCTGAGCTGGCTTTTTCTTGTGGCGATTCTAAAAGGTGT
CCAGTGTGTGCAGCTGGTGGAAAGCGGCGGCGGCGTGGTGCAGCCGGGCC
GCAGCCTGCGCCTGAGCTGCGCGGCGAGCGGCTTTGCGTTTAGCAGCTAT
GGCATGCATTGGGTGCGCCAGGCGCCGGGCAAAGGCCTGGAATGGGTGGC
GGTGATTTGGTTTGATGGCACCAAAAAATATTATACCGATAGCGTGAAAG
GCCGCTTTACCATTAGCCGCGATAACAGCAAAAACACCCTGTATCTGCAG
ATGAACACCCTGCGCGCGGAAGATACCGCGGTGTATTATTGCGCGCGCGA
TCGCGGCATTGGCGCGCGCCGCGGCCCGTATTATATGGATGTGTGGGGCA
AAGGCACCACCGTGACCGTGAGCAGCGCGAGCACCAAAGGCCCGAGCGTG
TTTCCGCTGGCGCCGAGCAGCAAAAGCACCAGCGGCGGCACCGCGGCGCT
GGGCTGCCTGGTGAAAGATTATTTTCCGGAACCGGTGACCGTGAGCTGGA
ACAGCGGCGCGCTGACCAGCGGCGTGCATACCTTTCCGGCGGTGCTGCAG
AGCAGCGGCCTGTATAGCCTGAGCAGCGTGGTGACCGTGCCGAGCAGCAG
CCTGGGCACCCAGACCTATATTTGCAACGTGAACCATAAACCGAGCAACA
CCAAAGTGGATAAACGCGTGGAACCGAAAAGCTGCGATAAAACCCATACC
TGCCCGCCGTGCCCGGCGCCGGAACTGCTGGGCGGCCCGAGCGTGTTTCT
GTTTCCGCCGAAACCGAAAGATACCCTGATGATTAGCCGCACCCCGGAAG
TGACCTGCGTGGTGGTGGATGTGAGCCATGAAGATCCGGAAGTGAAATTT
AACTGGTATGTGGATGGCGTGGAAGTGCATAACGCGAAAACCAAACCGCG
CGAAGAACAGTATAACAGCACCTATCGCGTGGTGAGCGTGCTGACCGTGC
TGCATCAGGATTGGCTGAACGGCAAAGAATATAAATGCAAAGTGAGCAAC
AAAGCGCTGCCGGCGCCGATTGAAAAAACCATTAGCAAAGCGAAAGGCCA
GCCGCGCGAACCGCAGGTGTATACCCTGCCGCCGAGCCGCGAAGAAATGA
CCAAAAACCAGGTGAGCCTGACCTGCCTGGTGAAAGGCTTTTATCCGAGC
GATATTGCGGTGGAATGGGAAAGCAACGGCCAGCCGGAAAACAACTATAA
AACCACCCCGCCGGTGCTGGATAGCGATGGCAGCTTTTTTCTGTATAGCA
AACTGACCGTGGATAAAAGCCGCTGGCAGCAGGGCAACGTGTTTAGCTGC
AGCGTGATGCATGAAGCGCTGCATAACCATTATACCCAGAAAAGCCTGAG
CCTGAGCCCGGGC
  • You now have two protein sequences that are components of the antibody Aducanumab.
  • To add this antibody molecule to the registry, go to the next step.

Register the Aducanumab Molecule (Optional Step)

  • Navigate to the Protein Sequences grid. Note the autogenerated names for the Light and Heavy Aducanumab chains.
  • Navigate to the Molecules page.
  • Select Create > Molecule.
  • On the Add details tab, in the Description field, enter the following. The number "1" anticipates that you might enter other conjugations of the Aducanumab molecule incorporating different leader sequences for the chains.
Aducanumab 1
  • In the Alias field, enter:
Aducanumab 1
  • Click Next.
  • On the Select components tab, confirm that Protein Sequences is selected. Using the dropdown, select the Aducanumab Light chain.
  • Using the dropdown a second time, select the Aducanumab Heavy chain.
  • Click Next.
  • On the Stoichiometry tab, notice that the system makes a best guess at the format. Accept the best guess by clicking Next.
  • On the Confirm tab, click Finish.

Tutorial Curriculum

Biologics Tutorial: Navigate and Search the Registry

Biologics Tutorial: Register Samples and Experiments

Discussion

Was this content helpful?

Log in or register an account to provide feedback


previousnext
 
expand all collapse all